‘Philip’ and ‘Tagg’
(names, names, names and DNA)

Tagg — English family name, probably of North German origin. Since it’s an English name, it is pronounced exactly like the English word tag [tæg]. It’s written with two Gs to distinguish it from the word tag. Though less common than Smith or Jones, Tagg is not an unusual English surname: there are tens of thousands of us.

Many English Taggs seem to hail from the southern part of Lincolnshire previously known as Holland (flat as a pancake and a lot of it under sea level).

The earliest Tagg I've found so far is Juliana, a potter from Toynton (probably Toynton All Saints, near Spilsby in central Lincolnshire).

“In 1364 Juliana Tagg took two crofts from the lord, Pottercroft and Wellcroft, for a term of years, during which time 'neither the lord nor his heirs shall disturb the said Juliana from digging and selling clay in the said croft pro ollis faciendis to whomsoever she pleases'.”
From Documentary Evidence and the Medieval Pottery Industry, by H. E. Jean Le Patourel, p. 114.

Taggs seem to have abounded in the area between Spalding and the Norfolk border. For example, in the mid nineteenth century Abraham Tagg married Cassandra Hunter, Benjamin Tagg married Jane Cooper, John Tagg married Mary Mashford and Thomas Tagg married Mary Parker, all in Fleet, Holbeach or Whaplode. My paternal grandfather, Joseph Tagg (b. c. 1870, see photo) was a blacksmith’s apprentice from Whaplode who became a Methodist minister.

The local phone book still includes a some Taggs but there are many more in London, California, New England, Michigan, Maryland, New York and across the Midwest. Apart from all the Taggs listed here, I could mention my brother Roger Tagg in Adelaide (South Australia), my brother Stephen Tagg near Glasgow (Scotland) and my daughter, Mia (Maria) Tagg.

Tagg seems to be the most common UK variant of the North German name Tagge. Lots of Tagges live in the Hamburg area. Apart from Tagge the optician, there’s Gerd Tagge, Holger Tagge (driving school), Birger Tagge (Senate of Hamburg University), Cassandra Tagge (Bergdorf Secondary School), Gilbert Tagge (volunteer firefighter), Jürgen Tagge, Carol Tagge, Dirk Tagge, etc. You can also get your engine tuned by Marcel Tagge in Klein Bünzow near the Polish border.

There’s even a Tagge Street in New Berlin, renamed Kitchener (Ontario) after the Germanophobia generated in Canada during World War I. Tagges are quite common in the border areas between Germany and Denmark (Schleswig-Holstein, see map.). Apart from Police Inspector Jrgen Tagge of Danish Immigration, the island of Fehmarn (Puttgarden, etc.) claims to be the origin of the name Tagge. There's also Karna Tagge of the Fredensborg Golf Club, Susanne Tagge(at StorageTek in Smørum) and Norwegian youth pole-vault-champion-turned fraudster Jørn Ronnie Tagge. For a longer list of Taggs and Tagges, click here.

Among musical / artistic / university Taggs online you'll find: John Tagg, James Tagg, Graeme Tagg, Kathleen or Kathy Tagg (South African pianist), Barbara Tagg, Stanley Tagg, Lawrence E Tagg, Lawrence V Tagg, Martyn Tagg, David Tagg, Graham Tagg (lead violin, Iceland Symphony Orchestra), Alan Tagg, brothers Peter and Derek Tagg (a.k.a. Richard Targett and Vic Austin respectively, both members of the band Trudy), Nick Tagg, Ken Tagg (record producer), etc., not to mention Larry Tagg (of Bourgeois Tagg fame) and Eric Tagg (adult contemporary fusion etc.). This preponderance of musical and university-type Taggs calls into question my strong aversion to genetic determinism: we all even look alike. Check also Annie Tagg (artist from Tennessee), Brian Tagg (retired film editor, living in Jamaica and involved in the nation's One People film project to celebrate the nation's fifty years of independence), Corey Tagg (DJ ‘Progressive House’), Dan Tagg (BBC, Director of Technology, Culture Online), and others in the ‘A few more Taggs’ list, below.

If Tagge and Tagg are names of Low German (North German/Danish) origin, what does tagg[e] mean? In Swedish and Norwegian tagg means thorn or spike. Tagg is also Swedish slang for a cigarette: guess how many times I heard the Philip Morris joke when I lived in Sweden (yawn). Nor does the fact that taggtråd means barbed wire in Swedish and Norwegian dissuade Scandinavians from making other sad puns on our name. Worse still, in English, nothing pleasant seems to rhyme with Tagg — bag, dag, drag, fag, gag, hag, jag, lag, nag, rag, sag, slag and wag, for example: only crag, flag and stag seem relatively inoffensive. My mother wisely advised me as a Tagg not to poke fun at other people’s names. Still, as my Swedish students once kindly remarked, ‘ingen ros utan tagg’ = ‘no rose without thorn’. Besides, if there’s nothing strange about being called Spike [e.g. Milligan] or [EMI-]Thorn[e] in English, what’s so weird about being called Tagg? As I said, we are legion and here to stay, at least until global warming melts the ice caps and releases all those billions of cubic kilometres of methane from the bottom of the ocean so that we end up like Venus (neighbouring planet, not the goddess of love). Why not start by scrapping all SUVs?

Philip — from Greek Philippos (phil- = like, love; [h]ippos = horse): literally a male person who loves horses. Neither my parents nor the Greeks of ancient times meant that people named Philip engage in erotic acts with horses. Perhaps the Greeks meant something like speed freak since horses were the fastest mode of transport at the time. My parents, with their keen sense of assonance and language rhythm knew that a two- or three-syllable name with an accentuated vowel other than A [æ] would sound better than, for example, Jan Tagg or Ralph Tagg.

Among famous men who may have played a part in popularising the name Philip are:

• Kings of Macedonia (Philip I, II [father of Alexander], III, IV; 640-180 B.C.)
• A general in Alexander the Great’s army (c. 350 BC)
• The Christian apostle and evangelist (1st century A.D.)
• Kings of France (Philip I-VI; 1050-1350)
• Ph de Vitry, French composer, music theorist and poet (1291-1361)
• Kings of Spain and Portugal, also Dukes of Burgundy (1350-1750)
• Wampanoag chief Metacomet/Philip who tried to befriend the New England pilgrims (c. 1660)
• Carl Philipp Emmanuel Bach, German composer (1714-1788; son of Johann Sebastian Bach)
• Philip Mountbatten, Duke of Edinburgh, Prince Consort to the UK’s Queen Elizabeth II
• Phil Spector (legendary 1960s US record producer)
• Phil Collins (popular British vocalist, 1980s-1990s)

This logo may have also contributed to the name’s popularity

Philip the hermeneutician
ἁρά γε γινὡσκεις ἄ ἀναγινὠσκεις
PVTASNE INTELLEGIS QVAE LEGIS
Understandest thou what thou readest?

In the Acts of the Apostles (New Testament of the Bible), chapter 8 (verses 26-38), we are told that an angel of God instructs Philip to ‘go toward the south unto the way that goeth down from Jerusalem unto Gaza’. The passage continues (complete passage in Latin | complete passage in κοινη Greek):

‘And he arose and went... And, behold, a man of Ethiopia, a eunuch of great authority under Candace queen of the Ethiopians, who had the charge of all her treasure, and had come to Jerusalem for to worship, was returning, and sitting in his chariot, reading Esaias the prophet.... Then the Spirit said unto Philip “Go near and join thyself to this chariot”. And Philip ran thither to him and heard him read the prophet and said “Understandest thou what thou readest?” And he [the Ethiopian] said “How can I, except some man should guide me? ...

After that Philip explains the passage about the Son of God being ‘led like a lamb to the slaughter’ and ends up baptising the Ethiopian. His hermeneutic skills of persuasion were certainly more effective than mine are.

Actus Apostolorum, 8: 26-38 (complete passage in Latin)

Angelus autem Domini locutus est ad Philippum, dicens “Surge et vade contra meridianum, ad viam quae descendit ab Hierusalem in Gazam: haec est deserta.” Et surgens abiit. Et ecce vir Aethiops, eunuchus, potens Candacis reginae Aethiopum, qui erat super omnes gazas eius, venerat adorare in Hierusalem et revertebatur sedens super currum suum, legensque prophetam Esaiam. Dixit autem Spiritus Philippo “Accede et adiunge te ad currum istum.” Adcurrens autem Philippus, audivit eum legentem Esaiam prophetam et dixit “Putasne intellegis quae legis?” Qui ait “Et quomodo possum, si non aliquis ostenderit mihi?” Rogavitque Philippum ut ascenderet et sederet secum. Locus autem scripturae quam legebat erat hic: “Tamquam ovis ad occisionem ductus est: et sicut agnus coram tondente se sine voce, sic non aperuit os suum. In humilitate iudicium eius sublatum est. Generationem illius quis enarrabit quoniam tollitur de terra vita eius.” Respondens autem eunuchus Philippo dixit “Obsecro te de quo propheta dicit hoc? De se an de alio aliquo?” Aperiens autem Philippus os suum et incipiens ab scriptura ista, evangelizavit illi Iesum. Et dum irent per viam, venerunt ad quandam aquam; et ait eunuchus: “Ecce aqua, quid prohibet me baptizari? Et iussit stare currum, et descenderunt uterque in aquam, Philippus et eunuchus, et baptizavit eum.

26 Ἄγγελος δὲ κυρίου ἐλάλησεν πρὸς Φίλιππον λέγων · Ἀνάστηθι καὶ πορεύου κατὰ μεσημβρίαν ἐπὶ τὴν ὁδὸν τὴν καταβαίνουσαν ἀπὸ Ἰερουσαλὴμ εἰς Γάζαν · αὕτη ἐστὶν ἔρημος 27 καὶ ἀναστὰς ἐπορεύθη, καὶ ἰδοὺ ἀνὴρ Αἰθίοψ εὐνοῦχος δυνάστης Κανδάκης βασιλίσσης Αἰθιόπων, ὃς ἦν ἐπὶ πάσης τῆς γάζης αὐτῆς, ὃς ἐληλύθει προσκυνήσων εἰς Ἰερουσαλήμ, 28 ἦν τε ὑποστρέφων καὶ καθήμενος ἐπὶ τοῦ ἅρματος αὐτοῦ καὶ ἀνεγίνωσκεν τὸν προφήτην Ἠσαΐαν 29 εἶπεν δὲ τὸ πνεῦμα τῷ Φιλίππῳ · Πρόσελθε καὶ κολλήθητι τῷ ἅρματι τούτῳ. 30 προσδραμὼν δὲ ὁ Φίλιππος ἤκουσεν αὐτοῦ ἀναγινώσκοντος Ἠσαΐαν τὸν προφήτην ⸃ καὶ εἶπεν · Ἆρά γε γινώσκεις ἃ ἀναγινώσκεις; 31 ὁ δὲ εἶπεν · Πῶς γὰρ ἂν δυναίμην ἐὰν μή τις ὁδηγήσει με; παρεκάλεσέν τε τὸν Φίλιππον ἀναβάντα καθίσαι σὺν αὐτῷ. 32 ἡ δὲ περιοχὴ τῆς γραφῆς ἣν ἀνεγίνωσκεν ἦν αὕτη · Ὡς πρόβατον ἐπὶ σφαγὴν ἤχθη, καὶ ὡς ἀμνὸς ἐναντίον τοῦ κείραντος αὐτὸν ἄφωνος, οὕτως οὐκ ἀνοίγει τὸ στόμα αὐτοῦ. 33 ἐν τῇ ταπεινώσει ἡ κρίσις αὐτοῦ ἤρθη · τὴν γενεὰν αὐτοῦ τίς διηγήσεται; ὅτι αἴρεται ἀπὸ τῆς γῆς ἡ ζωὴ αὐτοῦ. 34 ἀποκριθεὶς δὲ ὁ εὐνοῦχος τῷ Φιλίππῳ εἶπεν · Δέομαί σου, περὶ τίνος ὁ προφήτης λέγει τοῦτο; περὶ ἑαυτοῦ ἢ περὶ ἑτέρου τινός;  34 ἀποκριθεὶς δὲ ὁ εὐνοῦχος τῷ Φιλίππῳ εἶπεν · Δέομαί σου, περὶ τίνος ὁ προφήτης λέγει τοῦτο; περὶ ἑαυτοῦ ἢ περὶ ἑτέρου τινός; 35 ἀνοίξας δὲ ὁ Φίλιππος τὸ στόμα αὐτοῦ καὶ ἀρξάμενος ἀπὸ τῆς γραφῆς ταύτης εὐηγγελίσατο αὐτῷ τὸν Ἰησοῦν. 36 ὡς δὲ ἐπορεύοντο κατὰ τὴν ὁδόν, ἦλθον ἐπί τι ὕδωρ, καί φησιν ὁ εὐνοῦχος · Ἰδοὺ ὕδωρ, τί κωλύει με βαπτισθῆναι; 38 καὶ ἐκέλευσεν στῆναι τὸ ἅρμα, καὶ κατέβησαν ἀμφότεροι εἰς τὸ ὕδωρ ὅ τε Φίλιππος καὶ ὁ εὐνοῦχος, καὶ ἐβάπτισεν αὐτόν. 

54 more Taggs broken links removed or mended 2023-10-30 (family Taggs are here).
For reasons of security and privacy (see here) no Facebook, Linked-in, Instagram or Twitter addresses are included in this listing.

Alan Tagg	UK	Bristol	theatre designer
Andy Tagg	UK	Wallingford	dredger
Barbara Tagg	USA	Syracuse, NY	conductor, music teacher
Bernd Tagge	Germany	Lübeck/Hamburg	sports club organiser
Bill Tagg	USA	Hatfield	education and IT
Birger Tagge	Germany	Hamburg	student politics (Links, naturlich)
Brian Tagg	USA	Los Angeles, California	film editor
Catherine Tagg	UK	Cardiff, Wales	manager, Trevithick Library
Chris Tagg	UK	London	student services officer
Christine Tagg	USA		author (children's books)
David Tagg	USA	New York, NY	experimental musician
Donovan Tagg	UK	Lancaster	maths professor, my father
Eric Tagg	USA	Los Angeles, CA	musician
George Tagg	UK	London	community personality
Gerd Tagge	Germany	Hamburg	playground equipment
Graham Tagg	Canada		musician (viola)
Holger Tagge	Germany	Norderstedt (Stuttgart)	driving school
Howard Tagg	USA	Texas	bankruptcy lawyer
Jack Tagg	UK	Torquay, Devon	WW2 bomber pilot
James Tagg	UK		founder and CEO of Truphone
Jason Tagg	NZ/USA		performer and ukelele player
John Tagg	USA	Binghampton NY	prof Art History
Jørgen Tagge	Denmark	København	head of DK immigration police's xenophobia (shameful!)
Jørn Ronnie Tagge	Norway	Oslo	fraudster; ran T5PC pyramid scam
Joyce & Mem Tagg	Australia	Tasmania	botanists
Justin Tagg	UK	London/Lincoln	filmmaker/teacher
Kathleen/Kathy Tagg + here	S.Africa	New York, NY	Composer, pianist, singer- songwriter
Keith Tagg	Canada	Cochrane, AB	CEO, Tagg Construction
Ken Tagg	Australia	Campbelltown, NSW	Macdonald's franchise owner,citizen of the year
Larry Tagg + here	USA	Los Angeles, CA	musician
Liz Tagg	USA	Los Angeles, CA	make up artist and designer
Mairead Tagg	UK	Glasgow, Scotland	psychologist and my sister-in-law
Marcel Tagge	Germany	Klein Bünzow	AllCar Tuning
Maria (Mia) Tagg	UK	Liverpool	caterer, thinker and my daughter
Marilee Nebelsick-Tagg	USA	San Marcos, CA	professor of nursing education
Melissa Tagg	USA	New York	author
Nathan Tagg	UK	Glasgow	careers & community my nephew
Nathaniel Tagg	USA	Westerville, OH	neutrino specialist
Paul Tagg	UK	Northampton	software engineer
Roger Tagg	Australia	Adelaide, SA	retired university teacher, my brother
Ron Tagg	USA	Philadelphia	rock band "TAGG"
Sally Tagg	UK	Shrewsbury	home renovation and planning
Silvia Tagge	Germany	Radebeul	security manager
Stephen Tagg	UK	Glasgow, Scotland	retired university teacher and my brother
Susanne Tagge	DK		fabric design
Sven Tagge	Germany	Halle	political economist, Martin Luther Universität
Tagg Clothing	UK	Newark, Notts.	clothing
Tagg Computer Training	UK	London	computer training
Tagg Industries	USA	Laguna Hills, California	medical products
Tagg Logistics	USA	St Louis, Missouri	distribution, packaging
Tagg Oram Partnership	UK	Baldock, Herts.	Information technology
Tagg Plumbing	Australia	Kew, VIC	plumbers
Tagg's Island	UK	Hampton	in the Thames
Vicki Reppert Tagg	USA	Fort Ann, NY	amateur genealogist
James Tagg	USA		Indiana University, Bloomington

How much TAGG do you contain?

Here's a 780-letter sequence from the DNA part of the human genome [source]. It contains four TAGGs.

That's one TAGG every 175 letters ("bases") in the chain. I've absolutely no idea what, if anything, that means in real terms.

Update 2016-05-28. Keith TAGG sent me the following message today. ‘As a microbiologist I actually know what TAGG means in regards to DNA: replication and translation.’ Now I’d love to know what that actually implies.

TAGG: a string of bases in the PLP1 gene

"[E]ach gene contains the genetic code that tells cells how to make a specific protein. The genetic code is made up of a string of bases that are represented by the letters A, C, G and T. This string of bases represents a small region of the PLP1 gene: TAGGACATCCCGACAAG". I don't know what that means either.

It also appears that the TAGG motif "can inhibit splicing" in gene mutation. It appears that TAGG in the 30-letter motif GATATCGGATAGTGTAGGGCAGGCATCGAT is "particularly effective in provoking exon skipping, cumulating the effects of a stop codon with those linked to the creation of a splicing repression sequence" [source].